Quick Order

Mouse ACHE Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACHEcDNA Clone Product Information
cDNA Size:1844
cDNA Description:ORF Clone of Mus musculus acetylcholinesterase DNA.
Gene Synonym:mE1a, mE1b, mE1c, mE1d, mE1e, mE1d', mE1c-long, Ache
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.