After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NELL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NELL2cDNA Clone Product Information
cDNA Size:2601
cDNA Description:ORF Clone of Homo sapiens NEL-like 2 (chicken) DNA.
Gene Synonym:NRP2, NELL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Kuroda S, et al. (1999) Biochemical characterization and expression analysis of neural thrombospondin-1-like proteins NELL1 and NELL2. Biochem Biophys Res Commun. 265(1): 79-86.
  • Oyasu M, et al. (2000) Immunocytochemical localization of a neuron-specific thrombospondin-1-like protein, NELL2: light and electron microscopic studies in the rat brain. Brain Res Mol Brain Res. 76(1): 151-60.
  • Nelson BR, et al. (2002) Restricted neural epidermal growth factor-like like 2 (NELL2) expression during muscle and neuronal differentiation. Mech Dev. 119 Suppl 1: 11-9.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items