After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human KIRREL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIRRELcDNA Clone Product Information
cDNA Size:2274
cDNA Description:ORF Clone of Homo sapiens kin of IRRE like (Drosophila) DNA.
Gene Synonym:NEPH1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items