Quick Order

Text Size:AAA

Human Chitotriosidase / Chitinase 1 / CHIT1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHIT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003465.2
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Homo sapiens chitinase 1 (chitotriosidase) with C terminal HA tag.
Gene Synonym:CHI3, CHIT, FLJ00314, MGC125322
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

References
  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Size / Price
    Catalog: HG11223-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"