Quick Order

Text Size:AAA

Human FOLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FOLR2cDNA Clone Product Information
Gene_bank_ref_id:NM_000803.4
cDNA Size:768
cDNA Description:ORF Clone of Homo sapiens folate receptor 2 (fetal) DNA.
Gene Synonym:FR-P3, FR-BETA, BETA-HFR, FBP/PL-1, FOLR2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.

References
  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • Size / Price
    Catalog:HG11219-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"