After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CADM3 / NECL1 / IGSF4B transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CADM3 cDNA Clone Product Information
Gene_bank_ref_id:NM_021189
RefSeq ORF Size:1197bp
cDNA Description:Full length Clone DNA of Homo sapiens cell adhesion molecule 3, transcript variant 1 with C terminal HA tag.
Gene Synonym:BIgR, NECL1, TSLL1, IGSF4B, Necl-1, synCAM3, FLJ10698
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either with other CAMs of the same kind (homophilic binding) or with other CAMs or the extracellular matrix (heterophilic binding). Cell adhesion molecule 3, also known as Immunoglobulin superfamily member 4B, CADM3, and NECL1, is a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule which has Ca(2+)-independent homo- or heterophilic cell-cell adhesion activity and plays an important role in the formation of synapses, axon bundles and myelinated axons. Isoform 1 of CADM3 is expressed mainly in adult and fetal brain. Isoform 2 of CADM3 is highly expressed in adult brain and weakly expressed in placenta. In brain, Isoform 2 is highly expressed in cerebellum. CADM3 is involved in the cell-cell adhesion. It has both calcium-independent homophilic cell-cell adhesion activity and calcium-independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. The interaction with EPB41L1 may regulate structure or function of cell-cell junctions. CADM3 may act as a tumor suppressor in glioma and loss of it in glioma may be caused by histone deacetylation.

References
  • Dong X, et al. (2006) Crystal structure of the V domain of human Nectin-like molecule-1/Syncam3/Tsll1/Igsf4b, a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule. J Biol Chem. 281(15): 10610-7.
  • Gao J, et al. (2008) Nectin-like molecule 1 is a glycoprotein with a single N-glycosylation site at N290KS which influences its adhesion activity. Biochim Biophys Acta. 1778(6): 1429-35.
  • Gao J, et al. (2009) Loss of NECL1, a novel tumor suppressor, can be restored in glioma by HDAC inhibitor-Trichostatin A through Sp1 binding site. Glia. 57(9): 989-99.
  • Size / Price
    Catalog: HG11214-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"