Quick Order

Human IL17Rb Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL17RBcDNA Clone Product Information
cDNA Size:1509
cDNA Description:ORF Clone of Homo sapiens interleukin 17 receptor B DNA.
Gene Synonym:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-17 Family & Receptor Related Products
Product nameProduct name
Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Canine IL-17RD Protein (Fc Tag)Cynomolgus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Canine IL17RD Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human IL17RA / CD217 Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17RC Protein (Fc Tag)Human IL17RC Protein (aa 1-454, His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman IL-17F / Interleukin-17F Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinHuman RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL25 Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL-17F / IL17F ProteinRat IL17RA / IL17R Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Cynomolgus IL17RA / IL17R Protein (Fc Tag)Mouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Human IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks