Quick Order

Mouse CD55 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD55 cDNA Clone Product Information
Gene_bank_ref_id:NM_010016.2
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Mus musculus CD55 antigen with C terminal Myc tag.
Gene Synonym:Daf, Daf1, Daf-GPI, GPI-DAF, Cd55
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

References
  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
  • Size / Price
    Catalog: MG50468-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"