After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse JAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
JAM3cDNA Clone Product Information
cDNA Size:933
cDNA Description:ORF Clone of Mus musculus junction adhesion molecule 3 DNA.
Gene Synonym:JAM-3, JAM-C, Jcam3, C85515, 1110002N23Rik, Jam3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Junctional Adhesion Molecule C Protein & Antibody (JAM-C, JAM3 Protein) also known as Junctional adhesion molecule 3, JAM3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is an adhesion molecule expressed by endothelial cells (ECs) that plays a role in tight junction formation, leukocyte adhesion, and transendothelial migration. JAM-C is an adhesion molecule that is expressed on cells within the vascular compartment and epithelial cells and, to date, has been largely studied in the context of inflammatory events. JAM-C is also expressed in peripheral nerves and that this expression is localized to Schwann cells at junctions between adjoining myelin end loops. JAM-C is a component of the autotypic junctional attachments of Schwann cells and plays an important role in maintaining the integrity and function of myelinated peripheral nerves. JAM-C was recently shown to be a counter receptor for the leukocyte beta2-integrin Mac-1 (CD11b/CD18), thereby mediating interactions between vascular cells, particularly in inflammatory cell recruitment. JAM-C is up-regulated by oxidized low-density lipoprotein (LDL) and may thereby contribute to increased inflammatory cell recruitment during atherosclerosis. JAM-C may therefore provide a novel molecular target for antagonizing interactions between vascular cells in atherosclerosis. JAM-C was shown to undergo a heterophilic interaction with the leukocyte beta2 integrin Mac-1, thereby mediating interactions between vascular cells in inflammatory cell recruitment. JAM-C undergoes a homophilic interaction via the Arg64-Ile65-Glu66 motif on the membrane-distal Ig domain of the molecule. The homophilic interaction of JAM-C can mediate tumor cell-endothelial cell interactions and may thereby be involved in the process of tumor cell metastasis.

  • Keiper T, et al. (2005) The role of junctional adhesion molecule-C (JAM-C) in oxidized LDL-mediated leukocyte recruitment. FASEB J. 19(14): 2078-80.
  • Santoso S, et al. (2005) The homophilic binding of junctional adhesion molecule-C mediates tumor cell-endothelial cell interactions. J Biol Chem. 280(43): 36326-33.
  • Scheiermann C, et al. (2007) Expression and function of junctional adhesion molecule-C in myelinated peripheral nerves. Science. 318(5855): 1472-5.
  • Mandicourt G, et al. (2007) JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem. 282(3): 1830-7.
  • Betanzos A, et al. (2009) Evidence for cross-reactivity of JAM-C antibodies: implications for cellular localization studies. Biol Cell. 101(8): 441-53.
  • Rabquer BJ, et al. (2010) Junctional adhesion molecule-C is a soluble mediator of angiogenesis. J Immunol. 185(3): 1777-85.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items