After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse THY1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse THY1 cDNA Clone Product Information
Gene_bank_ref_id:NM_009382.3
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Mus musculus thymus cell antigen 1, theta with C terminal Myc tag.
Gene Synonym:T25, CD90, Thy-1, Thy1.1, Thy1.2, Thy-1.2, Thy1
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:pCMV3-mTHY1-Myc
Restriction Site:KpnI + XbaI (6kb + 0.53kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse THY1 Gene Plasmid Map
Mouse THY1 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

References
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Catalog: MG50461-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"