After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MTSS1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MTSS1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014751.4
RefSeq ORF Size:2268bp
cDNA Description:Full length Clone DNA of Homo sapiens metastasis suppressor 1 with N terminal His tag.
Gene Synonym:MIM, MIMA, MIMB, FLJ44694, KIAA0429, DKFZp781P2223, MTSS1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

MTSS1 (Metastasis suppressor 1), also known as Missing in metastasis (MIM), is a tissue-specific regulator of plasma membrane dynamics. MTSS1 is well described for its function as a metastasis suppressor gene and is expressed in a variety of tissues. MTSS1 might be involved in shaping neuronal membranes in vivo. MTSS1 deforms phosphoinositide-rich membranes through its I-BAR domain and interacts with actin monomers through its WH2 domain. MTSS1/MIM was first identified as a metastasis suppressor missing in metastatic bladder carcinoma cell lines. MTSS1 is a prognostic indicator of disease-free survival in breast cancer patients and demonstrates the ability to play a role in governing the metastatic nature of breast cancer cells. MTSS1 may serve as a useful biomarker for the prediction of outcome of gastric cancer. The down-regulation of MTSS1 that may be caused by DNA methylation was also observed in many other types of cancer.Recent work proposed that MIM also potentiates Sonic hedgehog (Shh)-induced gene expression. MTSS1 as a multiple functional molecular player and has an important role in development, carcinogenesis and metastasis.

References
  • Hayn-Leichsenring G, et al. (2011) Cellular distribution of metastasis suppressor 1 and the shape of cell bodies are temporarily altered in Engrailed-2 overexpressing cerebellar Purkinje cells. Neuroscience. 189: 68-78.
  • Xie F, et al. (2011) MTSS1: a multifunctional protein and its role in cancer invasion and metastasis. Front Biosci (Schol Ed). 3: 621-31.
  • Saarikangas J, et al. (2011) Missing-in-metastasis MIM/MTSS1 promotes actin assembly at intercellular junctions and is required for integrity of kidney epithelia. J Cell Sci. 2124(Pt 8): 1245-55.
  • Parr C, et al. (2009) Metastasis suppressor 1 (MTSS1) demonstrates prognostic value and anti-metastatic properties in breast cancer. Eur J Cancer. 45(9): 1673-83.
  • Size / Price
    Catalog: HG13085-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"