Quick Order

Human PGA4 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PGA4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001079808.1
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Homo sapiens pepsinogen 4, group I (pepsinogen A) with N terminal His tag.
Gene Synonym:PGA3, PGA5, FLJ58952, FLJ77962, PGA4
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-PGA4
Restriction Site:KpnI + XbaI (6kb + 1.17kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PGA4 (Pepsinogen 4, group I), or Pepsinogen A, is a member of the peptidase A1 family. Pepsin is expressed as a pro-form zymogen, pepsinogen, whose primary structure has an additional 44 amino acids. Pepsin is stored as pepsinogen so it will only be released when needed, and does not digest the body's own proteins in the stomach's lining. Five types of zymogens of pepsins, gastric digestive proteinases, are known: pepsinogens A, B, and F, progastricsin, and prochymosin. There are two major groups of pepsinogen, namely pepsinogen A (PGA) and pepsinogen C (PGC) (or progastricsin), and each frequently has isozymogens. The PGA3, PGA4 and PGA5 genes encode identical human pepsinogen A enzymes.

References
  • Kageyama T. (2002) Pepsinogens, progastricsins, and prochymosins: structure, function, evolution, and development. Cell Mol Life Sci. 59(2): 288-306.
  • Takahashi K. (1992) Gene structures of pepsinogens A and C. Scand J Clin Lab Invest Suppl. 210: 97-110.
  • Size / Price
    Catalog: HG13082-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"