After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Leptin Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LEPcDNA Clone Product Information
cDNA Size:504
cDNA Description:ORF Clone of Mus musculus leptin DNA.
Gene Synonym:ob, obese, Lep
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein

Leptin is one of the most important hormones secreted by adipocytes, as an adipokine that modulates multiple functions including energy homeostasis, thermoregulation, bone metabolism, endocrine and pro-inflammatory immune responses. The circulating leptin levels serve as a gauge of energy stores, thereby directing the regulation of energy homeostasis, neuroendocrine function, and metabolism. Recent studies suggest that leptin is physiologically more important as an indicator of energy deficiency, rather than energy excess, and may mediate adaptation by driving increased food intake and directing neuroendocrine function to converse energy, such as inducing hypothalamic hypogonadism to prevent fertilization. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone Leptin has been shown to regulate the immune response, innate and adaptive response, both in normal and pathological conditions. Thus, Leptin is a mediator of the inflammatory response. Leptin has a dual effect on bone, acting by two independent mechanisms. As a signal molecule with growth factor characteristics, leptin is able to stimulate osteoblastic cells and to inhibit osteoclast formation and activity, thus promoting osteogenesis. However, as a molecule which stimulates sympathetic neurons in the hypothalamus, leptin indirectly inhibits bone formation. This inhibitory effect of leptin mediated by activation of sympathetic nervous system can be abrogated by application of blood pressure-reducing beta-blockers, which also inhibit receptors of hypothalamic adrenergic neurons. Leptin appears to regulate a number of features defining Alzheimer's disease (AD) at the molecular and physiological level. Leptin can stimulate mitogenic and angiogenic processes in peripheral organs. Because leptin levels are elevated in obese individuals and excess body weight has been shown to increase breast cancer risk in postmenopausal women. Furthermore, a recent report clearly shows that targeting leptin signaling may reduce mammary carcinogenesis.

  • Surmacz E. (2007) Obesity hormone leptin: a new target in breast cancer? Breast Cancer Res. 9(1): 301.
  • Wodarski K, et al. (2009) Leptin as a modulator of osteogenesis. Ortop Traumatol Rehabil. 11(1): 1-6.
  • Tezapsidis N, et al. (2009) Leptin: a novel therapeutic strategy for Alzheimer's disease. J Alzheimers Dis. 16(4): 731-40.
  • Cai C, et al. (2009) Leptin in non-autoimmune inflammation. Inflamm Allergy Drug Targets. 8(4): 285-91.
  • Fernndez-Riejos P, et al. (2010) Role of leptin in the activation of immune cells. Mediators Inflamm. 2010: 568343.
  • Kelesidis T, et al. (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Ann Intern Med. 152(2): 93-100.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks