Quick Order

Mouse MSTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MSTNcDNA Clone Product Information
cDNA Size:1131
cDNA Description:ORF Clone of Mus musculus myostatin DNA.
Gene Synonym:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.


GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items