After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TSPAN1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TSPAN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005727.3
RefSeq ORF Size:726bp
cDNA Description:Full length Clone DNA of Homo sapiens tetraspanin 1 with N terminal His tag.
Gene Synonym:NET1, TM4C, TM4SF, TSPAN1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TSPAN1 belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins have four hydrophobic domains, intracellular N- and C-termini and two extracellular domains. Tetraspanins act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane. They also mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN1 interacts with human thiamine transporter-1 (hTHTR-1). HTHTR-1 contributes to intestinal thiamine uptake, and its function is regulated at both the transcriptional and posttranscriptional levels. TSPAN1 and hTHTR-1 colocalize in human intestinal epithelial HuTu-80 cells. Coexpression of TSPAN1 in these cells led to a significant decrease in the rate of degradation of hTHTR-1 compared with cells expressing the hTHTR-1 alone; in fact the half-life of the TSPAN1 protein was twice longer in the former cell type compared with the latter cell type.

References
  • Chen L. et al., 2010, J Korean Med Sci. 25 (10): 1438-42.
  • Chen L. et al., 2010, Tumori. 96 (5): 744-50.
  • Nabokina SM. et al., 2011, Am J Physiol Gastrointest Liver Physiol. 301 (5): G808-13.
  • Size / Price
    Catalog: HG13073-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"