Quick Order

Human GOLM1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GOLM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_016548.3
RefSeq ORF Size:1206bp
cDNA Description:Full length Clone DNA of Homo sapiens golgi membrane protein 1 with N terminal His tag.
Gene Synonym:GP73, GOLPH2, C9orf155, FLJ22634, FLJ23608, PSEC0257, bA379P1.3, GOLM1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Golgi membrane protein 1, also known as Golgi membrane protein GP73, Golgi phosphoprotein 2 and GOLM1, is a protein which belongs to the GOLM1 / CASC4 family. GOLM1 is widely expressed. It is highly expressed in colon, prostate, trachea and stomach. It is expressed at lower level in testis, muscle, lymphoid tissues, white blood cells and spleen. It is predominantly expressed by cells of the epithelial lineage. GOLM1 is expressed at low level in normal liver. Expression significantly increases in virus (HBV, HCV) infected liver. Expression of GOLM1 does not increase in liver disease due to non-viral causes (alcohol-induced liver disease, autoimmune hepatitis). Increased expression in hepatocytes appears to be a general feature of advanced liver disease. In liver tissue from patients with adult giant-cell hepatitis (GCH), GOLM1 is strongly expressed in hepatocyte-derived syncitial giant cells. GOLM1 is constitutively expressed by biliary epithelial cells but not by hepatocytes.

Size / Price
Catalog: HG13066-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"