After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RETN ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RETN cDNA Clone Product Information
Gene_bank_ref_id:BC069302
RefSeq ORF Size:327bp
cDNA Description:Full length Clone DNA of Homo sapiens resistin with N terminal His tag.
Gene Synonym:ADSF, RSTN, XCP1, FIZZ3, RETN1, MGC126603, MGC126609, RETN
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Verma S, et al. (2003) Resistin promotes endothelial cell activation: further evidence of adipokine-endothelial interaction. Circulation. 108(6):736-40.
  • Reilly MP, et al. (2005) Resistin is an inflammatory marker of atherosclerosis in humans. Circulation. 111(7):932-9.
  • Steppan CM, et al. (2002) Resistin and obesity-associated insulin resistance. Trends Endocrinol Metab. 13(1):18-23.
  • Size / Price
    Catalog: HG13055-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"