Quick Order

Text Size:AAA

Mouse THSD1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THSD1cDNA Clone Product Information
Gene_bank_ref_id:NM_019576.1
cDNA Size:2556
cDNA Description:ORF Clone of Mus musculus thrombospondin, type I , domain 1 DNA.
Gene Synonym:Tmtsp, AW121720, 4833423O18Rik, Thsd1
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Thrombospondin type-1 domain-containing protein 1, also known as transmembrane molecule with thrombospondin module, THSD1 and TMTSP, is a single-pass type I membrane protein which contains one TSP type-1 domain. THSD1 is a multi-domain, multi-functional glycoprotein synthesized by many cells. Matricellular THSD1 modulates cell adhesion and proliferation. It is involved in angiogenesis, inflammation, wound healing and cancer. In vitro, nanomolar concentrations of Thrombospondin-1 are required to alter endothelial and vascular smooth muscle cell adhesion, proliferation, motility, and survival. As a major platelet protein, for a long time it was postulated to control hemostasis via platelet aggregate stabilization. THSD1 is a potent angiogenesis inhibitor, and down-regulation of THSD1 has been suggested to alter tumor growth by modulating angiogenesis in a variety of tumor types.

References
  • Lawler J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med. 6(1): 1-12.
  • Ren B, et al. (2006) Regulation of tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta. 1765(2): 178-88.
  • Mirochnik Y, et al. (2008) Thrombospondin and apoptosis: molecular mechanisms and use for design of complementation treatments. Curr Drug Targets. 9(10): 851-62.
  • Bonnefoy A, et al. (2008) The evolving role of thrombospondin-1 in hemostasis and vascular biology. Cell Mol Life Sci. 65(5): 713-27.
  • Isenberg JS, et al. (2008) Thrombospondin-1: a physiological regulator of nitric oxide signaling. Cell Mol Life Sci. 65(5): 728-42.
  • Size / Price
    Catalog:MG50400-CM
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"