After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ENTPD1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ENTPD1 cDNA Clone Product Information
NCBI RefSeq:NM_009848.3
RefSeq ORF Size:1533bp
cDNA Description:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 1 with C terminal Myc tag.
Gene Synonym:Cd39, AA408691, NTPDase-1, 2610206B08Rik, Entpd1
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on activated lymphoid cells and can also be detected in endothelial tissues. The vascular isoform and the placental isoform II are present in both placenta and umbilical vein, whereas placental isoform I is present in placenta only. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. It is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 transgenic mice exhibit impaired platelet aggregation, prolonged bleeding times, and resistance to systemic thromboembolism. There is a correlation between ATP hydrolysis and triglycerides in patients with chronic heart disease, suggesting a relationship between ATP diphosphohydrolase and thrombogenesis. In the nervous system, CD39 could hydrolyze ATP and other nucleotides to regulate purinergic neurotransmission.

References
  • Kunzli BM, et al. (2011) Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 2011 56 (5): 1393-403.
  • Clayton A, et al. (2011) Cancer exosomes express CD39 and CD73, which suppress T cells through adenosine production. J Immunol. 187 (2): 676-83.
  • Loza MJ, et al. (2011) T-cell specific defect in expression of the NTPDase CD39 as a biomarker for lupus. Cell Immunol. 271 (1): 110-7.
  • Size / Price
    Catalog: MG50398-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"