After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FAM19A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAM19A2cDNA Clone Product Information
Gene_bank_ref_id:BC028403.1
cDNA Size:396
cDNA Description:ORF Clone of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 DNA.
Gene Synonym:TAFA2, TAFA-2, MGC42403, DKFZp761E1217, DKFZp781P0552, FAM19A2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human FAM19A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name
Background

FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.

References
  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"