After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KIR2DL3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KIR2DL3 cDNA Clone Product Information
Gene_bank_ref_id:BC032422
RefSeq ORF Size:1026bp
cDNA Description:Full length Clone DNA of Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 with N terminal His tag.
Gene Synonym:p58, NKAT, GL183, NKAT2, CD158b, NKAT2A, NKAT2B, CD158B2, KIR-K7b, KIR-K7c, KIRCL23, KIR-023GB
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.

References
  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • Size / Price
    Catalog: HG12828-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"