Quick Order

Human GOPC Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GOPCcDNA Clone Product Information
Gene_bank_ref_id:BC009553
cDNA Size:1365
cDNA Description:ORF Clone of Homo sapiens golgi-associated PDZ and coiled-coil motif containing DNA.
Gene Synonym:CAL, FIG, PIST, GOPC1, dJ94G16.2
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.

References
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Catalog:HG14911-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"