Quick Order

Human CLEC3B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC3BcDNA Clone Product Information
cDNA Size:609
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 3, member B DNA.
Gene Synonym:TN, TNA, DKFZp686H17246, CLEC3B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

  • Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.
  • Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.
  • Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.
  • Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.
  • Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.
  • Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items