Quick Order

Mouse CXCL10 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CXCL10 cDNA Clone Product Information
NCBI RefSeq:NM_021274.1
RefSeq ORF Size:297bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 10 with C terminal Myc tag.
Gene Synonym:C7, IP10, CRG-2, INP10, IP-10, Ifi10, mob-1, Scyb10, gIP-10, Cxcl10
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:pCMV3-mCXCL10-Myc
Restriction Site:KpnI + XbaI (6kb + 0.34kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CXCL10 Gene Plasmid Map
Mouse CXCL10 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

CXCL10, also known as crg-2, is a chemokine of the CXC subfamily and ligand for the receptor CXCR3. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL10 has a three-dimensional crystal structure. Its signaling is mediated by the g protein-coupled receptor CXCR3, which is expressed on activated T cells and plays an important role in directing the migration of T cells, especially during Th1 responses. Binding of CXCL10 to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. It is chemotactic for monocytes and T-lymphocytes. CXCL10 can be secreted by several cell types in response to IFN-γ. Baseline pre-treatment plasma levels of CXCL10 are elevated in patients chronically infected with hepatitis C virus (HCV) of genotypes 1 or 4 who do not achieve a sustained viral response (SVR) after completion of antiviral therapy.

References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
  • Size / Price
    Catalog: MG50139-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"