After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse TFPI Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TFPIcDNA Clone Product Information
cDNA Size:921
cDNA Description:ORF Clone of Mus musculus tissue factor pathway inhibitor DNA.
Gene Synonym:EPI, LACI, AW552122, A630013F22Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Tissue factor pathway inhibitor (TFPI) is the natural inhibitor of TF coagulant and signaling activities. It is a Kunitz-type serine proteinase inhibitor that down-regulates tissue factor-initiated blood coagulation. With its Kunitz domains, TFPI exhibits significant homology with human inter-alpha-trypson inhibitor and bovin basic pancreatic trypsin inhibitor. TFPI is the natural inhibitor of TF coagulant and signaling activities. The importance of TFPI in the regulation of blood coagulation is emphasized by how its activity is modulated in human disease. In a factor (F) Xa-dependent feedback system, TFPI binds directly and inhibits the TF-FVII/FVIIa complex. Normally, TFPI exists in plasma both as a full-length molecule and as variably carboxy-terminal truncated forms. TFPI also circulates in complex with plasma lipoproteins. The levels and the dual inhibitor effect of TFPI on FXa and TF-FVII/FVIIa complex offers insight into the mechanisms of various pathological conditions triggered by TF. TFPI may play an important role in modulating TF-induced thrombogenesis and it may also provide a unique therapeutic approach for prophylaxis and/or treatment of various diseases. In addition, Studies have shown that TFPI exhibits antiangiogenic and antimetastatic effects in vitro and in vivo. In animal models of experimental metastasis, both circulating and tumor cell-associated TFPI are shown to significantly reduce tumor cell-induced coagulation activation and lung metastasis.

  • Lwaleed BA, et al. (2006) Tissue factor pathway inhibitor: structure, biology and involvement in disease. J Pathol. 208(3): 327-39.
  • Amirkhosravi A, et al. (2007) The role of tissue factor pathway inhibitor in tumor growth and metastasis. Semin Thromb Hemost. 33(7): 643-52.
  • Maroney SA, et al. (2008) Expression of tissue factor pathway inhibitor by endothelial cells and platelets. Transfus Apher Sci. 38(1): 9-14.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items