Quick Order

Text Size:AAA

Human PI3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PI3 cDNA Clone Product Information
Gene_bank_ref_id:BC010952
RefSeq ORF Size:354bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidase inhibitor 3, skin-derived with N terminal His tag.
Gene Synonym:ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.

Size / Price
Catalog: HG12187-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"