Quick Order

Text Size:AAA

Mouse PD1 / PDCD1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PDCD1 cDNA Clone Product Information
Gene_bank_ref_id:NM_008798.1
RefSeq ORF Size:867bp
cDNA Description:Full length Clone DNA of Mus musculus programmed cell death 1 with C terminal Myc tag.
Gene Synonym:PD-1, Pdc1, Ly101
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:pCMV3-mPDCD1-Myc
Restriction Site:HindIII + NotI (6kb + 0.92kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse PDCD1 Gene Plasmid Map
Mouse PD1 / PDCD1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

References
  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • Size / Price
    Catalog: MG50124-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"