After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RFK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RFKcDNA Clone Product Information
cDNA Size:489
cDNA Description:ORF Clone of Homo sapiens riboflavin kinase DNA.
Gene Synonym:RIFK, RP11-422N19.2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Flavokinase is a member of the transferases family, specifically those transferring phosphorus-containing groups (phosphotransferases) with an alcohol group as acceptor. Flavokinase is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis. It has been proposed that TNF, through the activation of the flavokinase gene, enhances the incorporation of FAD in NADPH oxidase enzymes, which is a critical step for the assembly and activation of NADPH oxidase.

  • Hirano G, et al. (2011) Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin. Int J Oncol. 38(4):893-902.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items