After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB8cDNA Clone Product Information
Gene_bank_ref_id:NM_002640.3
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 DNA.
Gene Synonym:PI8, CAP2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10999-ACG$325
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10999-ACR$325
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10999-ANG$325
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10999-ANR$325
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10999-CF$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10999-CH$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10999-CM$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10999-CY$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone)HG10999-M$95
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10999-M-F$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10999-M-N$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10999-NF$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10999-NH$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10999-NM$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10999-NY$295
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10999-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catalog:HG10999-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"