Quick Order

Human SERPINA7 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINA7 cDNA Clone Product Information
Gene_bank_ref_id:NM_000354.4
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 with C terminal HA tag.
Gene Synonym:TBG,
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to the serpin family. TBG is synthesized primarily in the liver as a 54 kDa protein.TBG is genomically a serpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins (along with transthyretin and albumin) responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 in serum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with its ligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.

Size / Price
Catalog: HG10993-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"