Quick Order

Human FGFBP3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FGFBP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_152429.4
RefSeq ORF Size:777bp
cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor binding protein 3 with C terminal HA tag.
Gene Synonym:FGF-BP3, C10orf13, MGC39320
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human bFGF / FGF2 ProteinHuman aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Human FGF10 / KGF2 ProteinMouse / Rat aFGF / FGF1 ProteinMouse FGFR3 / CD333 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Human FGF21 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGF14 / SCA27 Protein (isoform 1B)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFBP3 Protein (His Tag)Cynomolgus FGFR3 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Human FGF6 / FGF-6 ProteinMouse FGFR2 / CD332 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Cynomolgus aFGF / FGF1 ProteinCanine FGF12 ProteinCanine aFGF / FGF1 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)
Background

FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates FGF-1 and FGF-2, thereby contributing to tumor angiogenesis. Fibroblast growth factors (FGFs) are important regulators of cell migration, proliferation and differentiation, e.g., during embryogenesis and wound healing, and under several pathological conditions including tumor growth and tumor angiogenesis. Expression of FGF-BP increases after injury to murine and human skin, in particular in keratinocytes. This upregulation is most likely achieved by major keratinocyte mitogens present at the wound site. FGFBP3 is a positive regulator of fibroblast growth factor receptor signaling pathway and vascular permeability. It interacts with 2,3,7,8-tetrachlorodibenzodioxine, benzopyrene and valproic acid. FGFBP3 also exhibits fibroblast growth factor binding (orthology) and heparin binding (orthology).

References
  • Abuharbeid S, et al. (2006) The fibroblast growth factor-binding protein FGF-BP. Int J Biochem Cell Biol. 38(9):1463-8.
  • Lange LG, et al. (1976) Human liver alcohol dehydrogenase: purification, composition, and catalytic features. Biochemistry. 15(21):4687-93.
  • Czubayko F, et al. (1997) A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 3(10):1137-40.
  • Size / Price
    Catalog: HG10986-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"