Quick Order

Text Size:AAA

Human MSN ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MSN cDNA Clone Product Information
NCBI RefSeq:BC017293
RefSeq ORF Size:1734bp
cDNA Description:Full length Clone DNA of Homo sapiens moesin with C terminal His tag.
Gene Synonym:MSN
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Moesin is a member of the ERM family which includes ezrin and radixin. ERM proteins, highly related members of the larger protein 4.1 superfamily, can exist in an active or inactive conformation. It seems that ERM proteins function as cross-linkers between plasma membranes and actin-based cytoskeletons. The sole Drosophila ERM protein, moesin, functions to promote cortical actin assembly and apical-basal polarity. As a result, cells lacking moesin lose epithelial characteristics and adopt invasive migratory behaviour. It is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. Moesin contains 1 FERM domain and is expressed in all tissues and cultured cells studied. Moesin has been shown to interact with CD43, Neutrophil cytosolic factor 1, VCAM-1, Neutrophil cytosolic factor 4, ICAM3 and EZR.

References
  • Lankes WT, et al. (1991) Moesin: a member of the protein 4.1-talin-ezrin family of proteins. Proc Natl Acad Sci. 88(19):8297-301.
  • Serrador, J M, et al. (1998) CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood. 91(12):4632-44.
  • Barreiro Olga, et al. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J Cell Biol. 157(7):1233-45.
  • Size / Price
    Catalog: HG13866-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"