Quick Order

Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACP1cDNA Clone Product Information
cDNA Size:477
cDNA Description:ORF Clone of Homo sapiens acid phosphatase 1, soluble , transcript variant 3 DNA.
Gene Synonym:HAAP, MGC3499, MGC111030
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10957-ACG$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10957-ACR$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10957-ANG$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10957-ANR$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10957-CF$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10957-CH$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10957-CM$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10957-CY$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG10957-M$95
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10957-M-F$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10957-M-N$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10957-NF$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10957-NH$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10957-NM$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10957-NY$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10957-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items