After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LSAMP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LSAMP cDNA Clone Product Information
Gene_bank_ref_id:BC033803
RefSeq ORF Size:1017bp
cDNA Description:Full length Clone DNA of Homo sapiens limbic system-associated membrane protein with N terminal His tag.
Gene Synonym:LAMP, IGLON3, FLJ34254, FLJ35396, FLJ37216, FLJ54658, LSAMP
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The limbic system-associated membrane protein (LAMP) is a cell surface glycoprotein expressed by cortical and subcortical regions of the mammalian CNS that comprise or receive direct projections from limbic system structures. The 64-68-kDa glycoprotein limbic system-associated membrane protein (LsAMP) is expressed on the surface of somata and proximal dendrites of neurons. These areas perform cognitive and autonomic functions, also learning and memory. The functional analysis indicates that LsAMP acts as a selective adhesion molecule, serving as a guidance cue for specific patterns of connectivity, which underlies the normal development of the limbic system. In animal studies there have been found that rats with increased level of anxiety had 1.6-fold higher expression of LsAMP gene in the periaqueductal gray compared to rats with low level of anxiety, indicating a possible role of LsAMP in the regulation of anxiety.

References
  • Zacco A. et al., 1990, The Journal of Neuroscience. 10(1): 73-90.
  • Pimenta AF. et al., 1996, Gene. 170(2) :189-95.
  • Size / Price
    Catalog: HG12136-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"