Quick Order

Mouse CGR2 / CD32 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FCGR2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001077189.1
RefSeq ORF Size:1023bp
cDNA Description:Full length Clone DNA of Mus musculus Fc receptor, IgG, low affinity IIb with C terminal Myc tag.
Gene Synonym:CD32, Fcgr2, Fcr-2, Fcr-3, Ly-17, LyM-1, Lym-1, FcgRII, Fcgr2a, Ly-m20, AI528646, Fc[g]RII, F630109E10Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Receptors for Fc portion of IgG (Fcγ Rs) are members of the Ig superfamily, and are divided into three classes designated Fcγ RI (CD64), Fcγ RII (CD32), and Fcγ RIII (CD16). CD32 protein is a low affinity receptor for IgG that binds only IgG immune complexes and is expressed on a diverse range of cells such as monocytes, macrophages, neutrophils, eosinophils, platelets, and B cells. Human CD32 class is encoded by three closely related genes, and designated Fcγ RII A, B, and C which share 94-99% amino acid identity in their extracellular domains but differ substantially in their transmembrane and cytoplasmic domains. CD32 is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators, and regulation of antibody production.

References
  • Williams TE, et al. (2000) Concurrent and independent binding of Fcgamma receptors IIa and IIIb to surface-bound IgG. Biophys J. 79(4): 1867-75.
  • Kanters D, et al. (2007) Expression of activated Fc gamma RII discriminates between multiple granulocyte-priming phenotypes in peripheral blood of allergic asthmatic subjects. J Allergy Clin Immunol. 120(5): 1073-81.
  • Veri MC, et al. (2007) Monoclonal antibodies capable of discriminating the human inhibitory Fcgamma-receptor IIB (CD32B) from the activating Fcgamma-receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 121(3): 392-404.
  • Size / Price
    Catalog: MG50030-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"