Quick Order

Text Size:AAA

Mouse CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD274cDNA Clone Product Information
cDNA Size:1116
cDNA Description:ORF Clone of Mus musculus CD274 antigen DNA.
Gene Synonym:B7-H1, PD-L1, Pdcd1l1, Pdcd1lg1
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Mouse CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged