Quick Order

Text Size:AAA

Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A6cDNA Clone Product Information
Gene_bank_ref_id:NM_014624.3
cDNA Size:273
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A6 DNA.
Gene Synonym:2A9, PRA, 5B10, CABP, CACY,
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10939-ACG$325
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10939-ACR$325
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10939-ANG$325
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10939-ANR$325
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10939-CF$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10939-CH$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10939-CM$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10939-CY$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone)HG10939-M$95
Human S100A6 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10939-M-F$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10939-M-N$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10939-NF$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10939-NH$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10939-NM$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10939-NY$295
Human S100A6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10939-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S100A6 (S100 calcium binding protein A6) is a member of the S100 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S100A6 have been implicated in melanoma.

References
  • Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.
  • Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.
  • Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22. 
  • Size / Price
    Catalog:HG10939-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"