Quick Order

Human BCL2L11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCL2L11cDNA Clone Product Information
cDNA Size:597
cDNA Description:ORF Clone of Homo sapiens BCL2-like 11 (apoptosis facilitator) DNA.
Gene Synonym:BAM, BIM, BIM-alpha6, BIM-beta6, BIM-beta7, BOD, BimEL, BimL, BCL2L11
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human BCL2L11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

BCL2L11, also known as Bim, belongs to the BCL-2 protein family. Members of this family form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. BCL2L11 contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family, including BCL2, BCL2L1/BCL-X(L), and MCL1, and to act as an apoptotic activator. BCL2L11 gene functions as an essential initiator of apoptosis in thymocyte-negative selection.

  • Day Catherine L. et al., 2004, Biochem J. 377 (3): 597-605.
  • Murray S. et al., 2001, Cytogenet Cell Genet. 92 (3-4): 353.
  • Hsu SY. et al., 1998,Mol Endocrinol. 12 (9): 1432-40.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items