After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human DNAJC30 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human DNAJC30 cDNA Clone Product Information
NCBI RefSeq:NM_032317.2
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 30 with C terminal His tag.
Gene Synonym:WBSCR18, DNAJC30
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

NAJC30 is a member of the DNAJ molecular chaperone homology domain-containing protein family. DNAJC30 gene is deleted in williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. DNAJC30 is expressed in brain, heart, kidney, liver, lung, spleen, stomach and testis. It contains 1 J domain. DNAJC30 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

References
  • Hillier L W, et al. (2003) The DNA sequence of human chromosome 7. Nature. 424:157-164.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • Merla G, et al. (2002) Identification of additional transcripts in the Williams-Beuren syndrome critical region. Hum Genet. 110:429-38.
  • Size / Price
    Catalog: HG13796-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"