Quick Order

Cynomolgus monkey SCG3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SCG3cDNA Clone Product Information
cDNA Size:1407
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) secretogranin III DNA.
Gene Synonym:SCG3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

SCG3, also known as secretogranin 3, is a member of the chromogranin/secretogranin family. Members of this family may serve as precursors for biologically active peptides. SCG3 is transported to secretory granules (SGs) in neuroendocrine cells. SCG3 binds strongly to chromogranin A (CgA) in an intragranular milieu and targets CgA to SGs in pituitary and pancreatic endocrine cells. With a sucrose density gradient of rat insulinoma-derived INS-1 cell homogenates, SgIII is localized to the SG fraction and is fractionated to the SG membrane (SGM) despite lacking the transmembrane region.

  • Rong YP. et al., 2002, Sheng Wu Wu Li Xue Bao. 34 (4): 411-7.
  • Huttner WB. et al., 1991, Trends Biochem Sci. 16 (1): 27-30.
  • Ozawa H. et al., 1996, Cell Struct Funct. 20 (6): 415-20.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items