Quick Order

Text Size:AAA

Human BCL6 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BCL6 cDNA Clone Product Information
Gene_bank_ref_id:NM_138931
RefSeq ORF Size:2121bp
cDNA Description:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6 with N terminal His tag.
Gene Synonym:ZBTB27, LAZ3, BCL5, BCL6A
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

References
  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Catalog: HG12083-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"