After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CD200 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD200 cDNA Clone Product Information
Gene_bank_ref_id:NM_005944.5
RefSeq ORF Size:810bp
cDNA Description:Full length Clone DNA of Homo sapiens CD200 molecule with C terminal HA tag.
Gene Synonym:MRC, MOX1, MOX2, OX-2, CD200
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-CD200-HA
Restriction Site:KpnI + XbaI (6kb + 0.85kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD200 Gene Plasmid Map
Human CD200 natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

References
  • Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.
  • Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.
  • Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.
  • Size / Price
    Catalog: HG10886-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"