Quick Order

Text Size:AAA

Human PHPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PHPT1cDNA Clone Product Information
Gene_bank_ref_id:NM_014172.5
cDNA Size:378
cDNA Description:ORF Clone of Homo sapiens phosphohistidine phosphatase 1 DNA.
Gene Synonym:PHPT1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.

References
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • Size / Price
    Catalog:HG16380-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"