Quick Order

Text Size:AAA

Human GALNT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GALNT2cDNA Clone Product Information
Gene_bank_ref_id:BC041120
cDNA Size:1716
cDNA Description:ORF Clone of Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) DNA.
Gene Synonym:GalNAc-T2, GALNT2
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. GALNT2 may play a role in lipid metabolism. It catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. GALNT2 has a broad spectrum of substrates for peptides such as EA2, Muc5AC, Muc1a, Muc1b.

References
  • Bennett EP. et al., 1998, Glycobiology. 8 (6): 547-55.
  • White T. et al., 1995, J Biol Chem. 270 (41): 24156-65.
  • Bennett EP. et al., 1996, J Biol Chem. 271 (29): 17006-12.
  • Holleboom AG. et al., 2011, Cell Metab. 14 (6): 811-8.
  • Size / Price
    Catalog:HG13764-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"