Quick Order

Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RELAcDNA Clone Product Information
Gene_bank_ref_id:NM_021975
cDNA Size:1701
cDNA Description:ORF Clone of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) DNA.
Gene Synonym:p65
Species:Human
Vector:pCMV3-N-His
Restriction Site:KpnI + XbaI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12054-ACG$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12054-ACR$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12054-ANG$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12054-ANR$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12054-CF$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12054-CH$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12054-CM$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12054-CY$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone)HG12054-G$125
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12054-NF$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12054-NH$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12054-NM$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12054-NY$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12054-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"