Quick Order

Text Size:AAA

Human MAOA ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAOA cDNA Clone Product Information
Gene_bank_ref_id:NM_000240
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Homo sapiens monoamine oxidase A with N terminal His tag.
Gene Synonym:MAOA
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Huang SY, et al. (2009) Association of monoamine oxidase A (MAOA) polymorphisms and clinical subgroups of major depressive disorders in the Han Chinese population. World J Biol Psychiatry. 10 (4): 544-51.
  • Guo G, et al. (2008) The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. Eur J Hum Genet. 16(5): 626-34
  • McDermott R, et al. (2009) Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. Proc Natl Acad Sci. 106 (7): 2118-23.
  • Size / Price
    Catalog: HG12051-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"