After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL17A ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL17A cDNA Clone Product Information
Gene_bank_ref_id:NM_002190
RefSeq ORF Size:468bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 17A with N terminal His tag.
Gene Synonym:IL-17A, IL-17
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Rhesus IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL-17RD Protein (Fc Tag)Rhesus IL17 / IL17a ProteinRhesus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Canine IL17RD Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Mouse IL25 Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL17RA / CD217 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Human IL-17F / Interleukin-17F Protein (His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman p38 delta / MAPK13 Protein (GST Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human IL17RC Protein (aa 1-454, His Tag)Human IL17RC Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17 / IL17A ProteinRat IL17RA / IL17R Protein (His Tag)Human p38 alpha / MAPK14 Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Rhesus IL17RA / IL17R Protein (Fc Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Human IL17 / IL17A Protein (His Tag)Human IL-17F / IL17F ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
Background

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

References
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Catalog: HG12047-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"