After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NQO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NQO1cDNA Clone Product Information
Gene_bank_ref_id:NM_000903.2
cDNA Size:825
cDNA Description:ORF Clone of Homo sapiens NAD(P)H dehydrogenase, quinone 1 DNA.
Gene Synonym:DHQU, QR1, DTD
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

NQO1 gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. NQO1 forms homodimers and reduces quinones to hydroquinones. NQO1's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in NQO1 gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of NQO1 has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. Recent pharmacological research suggests feasibility of genotype-directed redox chemotherapeutic intervention targeting NQO1 breast cancer, a common missense genotype encoding a functionally impaired NQO1 protein.

References
  • Ross David. et al., 2002, J Biol Chem. 277 (16): 14060-7.
  • Cabello CM. et al., 2010, Free Radic Res. 45 (3): 276-92.
  • Adesnik M. et al., 1988, J Biol Chem. 263 (27): 13572-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"