Quick Order

Human PLA2G1B ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLA2G1B cDNA Clone Product Information
Gene_bank_ref_id:NM_000928.2
RefSeq ORF Size:447bp
cDNA Description:Full length Clone DNA of Homo sapiens phospholipase A2, group IB (pancreas) with C terminal HA tag.
Gene Synonym:RLF, RLNL, MGC119818, MGC119819, INSL3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

References
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • Size / Price
    Catalog: HG10865-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"