Quick Order

Text Size:AAA

Human QPCT ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human QPCT cDNA Clone Product Information
Gene_bank_ref_id:BC047756
RefSeq ORF Size:1086bp
cDNA Description:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with C terminal His tag.
Gene Synonym:GCT, QC, sQC, QPCT
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

References
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catalog: HG13752-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"